|
20 regulation began in 1962, the Alliance's argument ignores our Nation's history of drug safety regulation described above. Nor can the Alliance override current FDA regulations simply by insisting that drugs which have completed Phase I testing are safe enough for terminally ill patients. Current law bars public access to drugs undergoing clinical testing on safety grounds. The fact that a drug has emerged from Phase I with a determination that it is safe for limited clinical testing in a controlled and closely-monitored environment after detailed scrutiny of each trial participant does not mean that a drug is safe for use beyond supervised trials.11 FDA regulation of postPhase I drugs is entirely consistent with our historical tradition of prohibiting the sale of unsafe drugs!
The volume and composition of airway surface liquid ASL ; is important for mucociliary clearance and airways defense, little is known about the chronic regulation of this liquid layer. The depth and composition of ASL are thought to be regulated by the rates of ion transport and the linked osmotic volume flow. In most airway epithelia, the amiloride-sensitive epithelial Na channel is an important element that regulates the rate of absorptive volume flow and the ionic composition of ASL. Little is known about the physiological regulation of the epithelial Na channel ENaC ; in airway epithelia. In the genetic disease cystic fibrosis CF ; , the rate of Na absorption is markedly upregulated in vivo and in vitro across airway epithelia in both human 20, 21, 23 ; and mouse proximal airways 15 ; . It has been shown that the product of the normal CF gene [cystic fibrosis transmembrane conductance regulator CFTR ; ] tonically inhibits amiloride-sensitive Na absorption across airway epithelia 31 ; , and, in CF, absent or defective CFTR is associated with an elevated rate of Na absorption 31 ; . In the renal distal tubules and colonic epithelia, both mineralocorticoid aldosterone ; and glucocorticoid horDESPITE THE LIKELIHOOD THAT.
M. Guichelaar, J.vanBaarlen, M.R Groot, M.R haafsma Medical Spectrum Twente, Department of Internal Medicine, Ariensplein 1, 7511 JX ENSCHEDE, the Netherlands, e-mail: maureenguichelaar yahoo Introduction: Alemtuzumab is a monoclonal antibody CLL ; . Alemtuzumab treatment results into a severe depletion of mature B- and T-lymphocytes, natural killer cells and monocytes which may persist for over 1 year. Due to its profound immunological effects a new era of infective diseasesariseinoncologypatients, whichweillustratein thisrarecase. Case: modalities included chlorambucil and fludarabine after which he developed CLL recurrences. After his fifth week of alemtuzumab treatment the patient developed symptoms of profuse watery diarrhea, with a frequency.
Intermittent, usually once daily, administration of parathyroid hormone PTH ; is capable of increasing bone mass in osteoporotic postmenopausal women 6, 18, 22 ; . Similarly, PTH can reverse bone loss in moderately osteopenic ovariectomized rats 24, 26 ; . Estrogen is a potent inhibitor of bone turnover but neither estrogen nor estrogen analogs have been reported to antagonize the bone anabolic response to intermittent PTH treatment in women or female rats 5, 16, 26 . Although these results suggest that estrogen is neither essential for nor detrimental to the bone anabolic response to PTH, not all patients respond positively to PTH treatment 2, 11 ; . This important observation indicates that genetic and environmental factors influence the bone anabolic response to PTH. Identification of these factors is important to maximizing the efficacy of PTH therapy in osteoporotic patients.
149; your healthcare provider will store fludarabine as directed by the manufacturer.
Selective inhibitor of protein kinase C. Cancer Chemother. Pharmacol., 32: 183189, 1993. Wang, Q., Fan, S., Eastman, A., Worland, P. J., Sausville, E. A., and O'Connor, P. M. UCN-01: a potent abrogator of G2 checkpoint function in cancer cells with disrupted p53. J. Natl. Cancer Inst., 88: 956 965, Bunch, R. T., and Eastman, A. Enhancement of cisplatin-induced cytotoxicity by 7-hydroxystaurosporine UCN-01 ; , a new G2-checkpoint inhibitor. Clin. Cancer Res., 2: 791797, 1996. Bunch, R. T., and Eastman, A. 7-Hydroxystaurosporine UCN-01 ; causes redistribution of proliferating cell nuclear antigen and abrogates cisplatin-induced S-phase arrest in Chinese hamster ovary cells. Cell Growth Differ., 8: 779 788, Shao, R. G., Cao, C. X., Shimizu, T., O'Connor, P. M., Kohn, K. W., and Pommier, Y. Abrogation of an S-phase checkpoint and potentiation of camptothecin cytotoxicity by 7-hydroxystaurosporine UCN-01 ; in human cancer cell lines, possibly influenced by p53 function. Cancer Res., 57: 4029 4035, Shi, Z., Azuma, A., Sampath, D., Li, Y-X., Huang, P., and Plunkett, W. S-Phase arrest by nucleoside analogues and abrogation of survival without cell cycle progression by 7-hydroxystaurosporine. Cancer Res., 61: 10651072, 2001. Graves, P. R., Yu, L., Schwarz, J. K., Gales, J., Sausville, E. A., O'Connor, P. M., and Piwnica-Worms, H. The Chk1 protein kinase and the Cdc25C regulatory pathways are targets of the anticancer agent UCN-01. J. Biol. Chem., 275: 5600 5605, Sausville, E. A., Arbuck, S. G., Messmann, R., Headlee, D., Bauer, K. S., Lush, R. M., Murgo, A., Smith, A. C., Figg, W. D., Lahusen, T., Jaken, S., Jing, X., Roberge, M., Fuse, E., Kuwabara, T., and Senderowicz, A. M. Phase I trial of 72-hour continuous infusion UCN-01 in patients with refractory neoplasms. J. Clin. Oncol., 19: 2319 2333, Jiang, H., and Yang, L-Y. Cell cycle checkpoint abrogator UCN-01 inhibits DNA repair: association with attenuation of the interaction of XPA and ERCC1 nucleotide excision repair proteins. Cancer Res., 59: 4529 4534, Chaney, S. G., and Sancar, A. DNA repair: enzymatic mechanisms and relevance to drug response. J. Natl. Cancer. Inst., 88: 1346 1360, Lindahl, T., and Wood, R. D. Quality control by DNA repair. Science Wash. DC ; , 286: 18971905, 1999. Wood, R. D. DNA repair in eukaryotes. Annu. Rev. Biochem., 65: 135167, 1996. Sandoval, A., Consoli, U., and Plunkett, W. Fludarabine-mediated inhibition of nucleotide excision repair induces apoptosis in quiescent human lymphocytes. Clin. Cancer Res., 2: 17311741, 1996. Kawai, Y., and Plunkett, W. DNA repair induced by 4-hydroperoxycyclophosphamide permits fludarabine nucleotide incorporation and is associated with synergistic induction of apoptosis in quiescent human lymphocytes. Blood, 94: 655a, 1999. Yamauchi, T., Nowak, B. J., Keating, M. J., and Plunkett, W. DNA repair initiated in chronic lymphocytic leukemia lymphocytes by 4hydroperoxycyclophosphamide is inhibited by fludarabine and clofarabine. Clin. Cancer Res., 7: 3580 3589, Tew, K. D., Colvin, M., and Chabner, B. A. Alkylating agents. In: B. A. Chabner and D. L. Longo eds. ; , Cancer Chemotherapy and Biotherapy, pp. 297317. Philadelphia: Lippincott-Raven Publishers, 1996. 25. Ludeman, S. M. The chemistry of the metabolites of cyclophosphamide. Curr. Pharm. Des., 8: 627 643, Moran, J., Siegel, D., Sun, X-M., and Ross, D. Induction of apoptosis by benzene metabolites in HL60 and CD34 human bone marrow progenitor cells. Mol. Pharmacol., 50: 610 615, Thompson, L. H. 18 Nucleotide excision repair. In: J. A. Nickoloff and M. F. Hoekstra eds. ; , DNA Damage and Repair, Vol. 2. DNA Repair in Higher Eukaryotes, pp. 335393. Totowa, NJ: Humana Press, Inc., 1998. 28. Muller, M. R., Buschfort, C., Thomale, J., Lensing, C., Rajewsky, M. F., and Seeber, S. DNA repair and cellular resistance to alkylating agents in chronic lymphocytic leukemia. Clin. Cancer Res., 11: 2055 2061 and flumist.
Full dose of each in this combination regimen, without untoward effects. The major toxicities of the combination regimen were gastrointestinal including transient liver test abnormalities, nausea vomiting, diarrhea, and mucositis. Although skin rashes were frequently observed, they rarely exceeded grade 2 by NCI toxicity criteria. CNS toxicity was not observed. This was in contrast to the fludarabine and ara-C combination treatment, where 8 of 219 3.7% ; patients suffered from neurotoxicity.
Fludarabine prophylaxis
Clinical specimens DNA extraction for PCR amplification of IgH genes was performed on pretreatment specimens that consisted of diagnostic lymph node biopsies, involved bone marrow, or peripheral blood with a circulating lymphocytosis. All lymph node and bone marrow biopsy specimens were reviewed by MSKCC hematopathologists. During protocol treatment, peripheral blood and bone marrow were obtained for analysis after 3 and 6 cycles of fludarabine and after 3 cycles of high-dose cyclophosphamide. Bone marrow aspirates were collected in EDTA for DNA extraction for PCR and in heparin sulfate for flow cytometry. When available, bone marrow was preferentially used in the analysis. Mononuclear cells were isolated by Ficoll gradient and stored at 140C in liquid nitrogen. DNA extraction was performed with proteinase K and was purified using a QIAamp spin column QIAGEN, Chatsworth, CA ; . In 2 instances, follow-up samples of fresh bone marrow aspirates were unavailable, and DNA was extracted from bone marrow aspirates or paraffin section using octane for paraffin removal. The minute amount of material obtained precluded accurate determination of its concentration without losing the DNA. Therefore, results from these reactions were strictly qualitative. Polymerase chain reaction amplification of rearranged IgH genes The experimental design is illustrated in Figure 1. The rearranged VH gene from B cell tumors was amplified, as previously described, using upstream primers based on a set of 6 family-specific VH leader primers18 in conjunction with a consensus JH primer.4 The latter was modified by the 5 addition of a T7 sequence, facilitating sequencing and destabilizing a 5 -end loop that could interfere with the primer's performance. PCR reactions were carried out in 50- L volumes containing 100 ng template DNA, 0.5 M each of the 5 and 3 primers, 200 M each dNTP, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, and 0.625 U Amplitaq Perkin-Elmer Cetus, Norwalk, CT ; . The samples were overlain with 100 L mineral oil and subjected to 37 cycles of denaturation 15 seconds at 95C; first cycle, 3 minutes ; , annealing 15 seconds at 55C; 30 seconds, first cycle ; , and elongation 15 seconds at 72C; 30 seconds, first cycle ; using the Perkin-Elmer thermal cycler. After the last cycle, a final elongation step for 7 minutes at 72C was performed. PCR fragments 10 L ; were separated on 1.2% agarose gels in 90 mM Tris-borate2 mM EDTA TBE buffer ; and visualized with ethidium bromide staining. In the event that this approach failed to reveal a monoclonal band, an alternative set of primers based on Fr2a and Fr3a consensus sequences were used with a downstream semi-nested pair of JH primers LJH and VLJH ; , as previously described, with minor modifications.19-21 PCR conditions were identical to those above with the exception of the cycling conditions, as follows: an initial denaturation step at 95C for 7 minutes, followed by 3 cycles of denaturation 45 seconds at 93C ; , annealing 45 seconds at 50C ; , and elongation 110 seconds at 72C ; . After the last cycle, a final elongation step for 7 minutes at 72C was performed. The second round of amplification with the semi-nested 3 was carried out under the same conditions. All experiments were run with a negative and a positive control. The former consisted of all the PCR reagents in the absence of a DNA template. The latter used alternative primer pairs for the bcl-2 untranslated region bcl-2 UT 5 TCAGCCTTGAAACATTGATG and bcl-2 UT 3 CAAGGTCAAAGGGACAACAG ; , which amplified under the same conditions as the immunoglobulin VH-family specific leader primers, resulting in a 450-bp fragment. The positive control verified the integrity of the DNA template. To prevent contamination, simultaneous amplification of a positive control template was not performed. PCR reactions were carried out in a dedicated hood into which amplified PCR products were never introduced. Clone-specific primer design Nested primer pairs unique to the malignant clone for the detection of MRD were created based on the sequence of the CDR-III region of the malignant and fluoride.
Fludarabine chemotherapy
Figure 1. A, Clinical appearance of a lentigo maligna LM ; of the right neck. The black arrow indicates the border depicted by means of digital epiluminescence microscopy DELM ; . B, The DELM image of the border of LM shows a pigmented thin mesh. Blue star indicates the area depicted in Figure 2B.
Although studies support the familial transmission of alcohol and substance dependence, individuals are frequently dependent on multiple substances, raising the possibility of a general addictive tendency. By examining the most common substances on which subjects from the COGA were dependent--alcohol, marijuana, cocaine, and habitual smoking--we sought to clarify the familial relationship between them. The first aim was to examine the influence of comorbid substance dependence in alcohol-dependent probands on the rate of developing alcohol dependence in their siblings. A lifetime diagnosis of alcohol dependence was present in half of the brothers and one quarter of the sisters of alcohol-dependent subjects. Regardless of the presence or absence of comorbid substance dependence, rates of alcohol dependence in siblings were stable. This result was not consistent with a continuum model of severity of addiction influencing the familial clustering of alcoholism, since one would have expected a more severe form of addiction in probands alcohol and comorbid drug dependence ; to confer a greater risk to siblings for the development of alcohol dependence compared with a less severe form of addiction in probands alcohol dependence only ; . The second aim of these analyses was to evaluate the risk of developing marijuana dependence, cocaine dependence, and habitual smoking in siblings of alcoholdependent probands. The risk for developing these disorders was elevated in siblings with and without alcohol dependence, and was related to the presence of substance dependence in the probands. Thus, the increased risk of developing substance dependence was in part independent of the familial transmission of alcoholism. Finally, there was substance-specific familial transmission of dependence even after many associated variables that may result in association of dependence among siblings were taken into account. Marijuana dependence in probands specifically increased the risk of marijuana dependence in siblings, and cocaine dependence in probands specifically increased the risk of cocaine dependence in siblings. An analysis of habitual smoking, a proxy for tobacco dependence, also found a specific familial pattern. Substance dependence in individuals did not result in a general increase in all forms of dependence in their siblings, but instead resulted in a substance-specific increase in dependence. This result was consistent with previous studies9-13 that did not support a model of only a "general addictive tendency" for all forms of addiction. In addition to these substance-specific transmission factors, these analyses supported a common risk factor for dependence that was transmitted in families. Alcohol dependence in probands increased the risk of and fluphenazine.
Guidelines for response were those developed by the NCI Sponsored Working Group.14 Complete response CR ; required the absence of symptoms and organomegaly and the return to a normal blood count, with granulocyte count greater than 1.56109 l, platelet count 41006109 l, hemoglobin concentration 411.0 g dl, and bone marrow of normal cellularity, with less than 30% lymphocytes in the aspiration smear. Bone marrow biopsy was required two months after the evidence of clinical CR. Bone marrow biopsy and aspirate had to be at least normocellular and with 530% of nucleated cells being lymphocytes and an absence of lymphoid nodules. Patients fullling the criteria stated above but with persistent lymphoid nodules in bone marrow biopsy were classied as nodular partial response nPR ; . Partial response PR ; was considered as 50% or greater decrease in the size of lymph nodes, liver and spleen, and peripheral blood ndings either identical to those of CR, or improved over pretherapy values by at least 50%. Patients who did not achieve CR or PR were classied as non-responders NR ; . Clinical relapse was dened according to Robertson et al.19 as increase in the absolute lymphocyte count above 106109 l, more than 50% increase in the sum of the sizes of at least two lymph nodes, appearance of new lymph nodes, more than 50% increase in the liver or spleen below the costal margin, new appearance of palpable hepatosplenomegaly or development of an aggressive lymphoma.
Guillain-Barre syndrome GBS ; is a group of autoimmune syndromes consisting of demyelinating and acute axonal degenerating forms of the disease We described a case of a patient with chronic myeloid leukaemia and GBS, improved after allogenic stem cells transplantation.The patient male, 46 years old ; had the diagnosis of chronic myeloid leukaemia at the age of 43 years; treated with STI 587, after 3 years his condition improved in accelerated disease stage. He underwent chemotherapy with VP-16 and Ara-C and obtained a long phase of aplasia with undercapsular splenic haematoma with following splenectomy. The clinic assessment was complicated by a mixed motor sensitive polyradiculitis. Patient exhibit a progressive paralysis that reaches a plateau phase. NMR and EMG studies confirmed GBS. The patient underwent HLA sibling donor transplantation in May 2006. In order to reduce the drug toxicity, the conditioning was with Thiotepa, Fludarabine and Melphalan, followed by allogenic depleted T and B PBSC infusion, without GvHD prophylaxis. Engraftment was at day + 14 Neutrophilis 0, 5 109 L ; . The post-transplant program included donor lymphocyte infusion in order to speed up the immunological reconstitution for the infectious risks and disease's control. Also, he was treated with DLI every 3-4 weeks total: 5 infusions ; . After the follow-up at 330 days, the patient shows a quantitative chymerism of 83% with riarrangiament BCR ABL of 5000 copies. From a clinic and neurological point of view, the patient obtained a gradual neurological recovery, documented by neurological revaluation. At the moment, has been documented the recovery of the deambulation and flurazepam.
Contains a special skin conditioner to prevent skin from drying out. Citrus fragrance. Effectively sanitizes hands without water. Equally as disinfecting as liquid alcohol.
Animals. Male Sprague-Dawley-derived rats weighing 325375 g were purchased from Harlan Indianapolis, IN ; . They were housed individually in hanging wire cages for at least 1 wk before experimentation. Purina Rat Chow, tap water, and 0.3 M NaCl were available ad libitum except during the experimental periods. Room lights were on for 12 h day, and temperature was controlled at 23C. Cannulation procedures. Animals were anesthetized with Equithesin 0.33 ml 100 g body wt ; and secured in a Kopf 900 stereotaxic instrument. The skull was exposed by midline incision and held level. One 26-gauge stainless steel guide cannula was implanted into the left lateral cerebral ventricle and flurbiprofen.
LUDARABINE, a nucleoside analogue, has significant antitumor activity in chronic lymphocytic leukemia CLL ; . Fludarabine therapy in CLL results in a response rate of 50 to 55% in previously treated patients, and the rate increases to 70%in previously untreated patients.'f2 Prednisone, a lymphocytotoxic agent, is frequently used in combination with chlorambucil in the treatment of CLL.3In an attempt to improve the remission rates and duration of remission in CLL, we have initiated a study using the combination of fludarabine and prednisone to treat patients with CLL. The results pertinent to remission rates and survival and to factors influencing response to fludarabine, as well as the incidence of complications, are summarized in this analysis.
Addition of anti-lymphocyte serum.3' Also, lethal or sublethal doses of DMM had no effect on humoral antibody responses against slight sheep effect RBCs on responses or allogeneic leukocytes, 4x174 and only a to bacteriophage in dogs.32 and fluvastatin.
If code 2 at LowType Thinking about the denture in your LOWER jaw. How long have you had your present denture in your lower jaw? CODE RESPONSE IN YEARS 0-65 ; 0.65 and fludarabine.
Other FDA Approvals of Interest Campath alemtuzumab ; Genzyme Corp. and FDA approved single-use vial Belex Inc. unit drug is used for chronic B-cell of Schering AG ; lymphocytic leukemia in patients who have been treated with alkylating agents and who have failed fludarabine therapy ; QLT Inc. and Sanofi-Aventis Group Amgen Six-month sustained release formulation drug is used for palliative treatment of advanced prostate cancer ; 10 18 04 and focalin!
Maura Brugiatelli Giuseppe Bandini Giovanni Barosi Francesco Lauria Vincenzo Liso Monia Marchetti Francesca Romana Mauro Giovanna Meloni Pier Luigi Zinzani Sante Tura Objectives. The Italian Society of Hematology SIE ; and two affiliate societies SIES and GITMO ; commissioned a project to develop clinical practice guidelines for the treatment of chronic lymphocytic leukemia CLL ; . Methods. Key questions in the management of patients with CLL were formulated by an Advisory Committee and approved by an Expert Panel of eight senior hematologists. After a systematic review of the literature, recommendations for disease-specific and supportive therapies were formulated and graded according to the supporting evidence. Explicit consensus methods were used for providing recommendations for questions with incomplete or potentially biased evidence. Results. It is recommended that therapy is commenced in patients with CLL when at least one of the following are present: B-symptoms, progressive obstructive lymphadenopathy or organomegaly, rapid lymphocyte doubling time, anemia or thrombocytopenia of new onset, worsening or steroid-resistant ; . It is recommended that patients without co-morbidity should receive fludarabine plus cyclophosphamide, whereas elderly patients with co-morbidity should receive oral chlorambucil. Younger patients with unfavorable biological risk factors should be considered for high-dose chemotherapy and autologous or allogeneic stem cell transplantation within approved clinical trials. Patients either relapsing rapidly after, or non-responsive to, first-line chlorambucil should receive fludarabine-containing regimens. Patients either relapsing soon after or not responding to fludarabine-based chemotherapy should be considered for schedules including non-cross-reactive agents, such as alemtuzumab, possibly followed by highdose chemotherapy and autologous transplantation in the context of a clinical trial or by allogeneic stem cell transplantation. Conclusions. We describe the results of a systematic literature review and an explicit approach to consensus techniques which resulted in recommendations for the key therapeutic decisions in patients with CLL.
Questions 1 Since you began treatment with the test drug, do you feel that any change in weight has had a significant or ; impact on your health? 2 Are you more ; or less ; concerned about your weight now than when you started treatment? A "more concerned" response would be a negative answer. 3 To what extent has your appearance changed for the better ; or worse ; since treatment was started? 4 Based on comments from friends, loved ones, and coworkers, how do you feel your appearance has changed for the better ; or worse ; since the start of treatment? 5 To what extent has your appetite changed for the better ; or worse ; since the start of the treatment? 6 Do you enjoy eating more ; or less ; than before? 7 Since beginning this treatment do you feel better ; or worse ; overall? 8 Do you think this treatment has been of benefit or ; to you? 9 Since beginning treatment, has your quality of life become better ; or worse ; ? n MA Value 0.005 and follistim.
Table 15. Each individual initiating without responding to each other. 30 4 and flumist.
Mortimer, P. S. 1995, "Managing lymphedema", Clinics in Dermatology, vol. 13, no. 5, pp. 499-505. Reason for exclusion: Title abstract first pass ; : Excluded. Mosci, C., Polizzi, A., & Zingirian, M. 2001, "Transpupillary thermotherapy for circumscribed choroidal hemangiomas: First choice in therapy", European Journal of Ophthalmology, vol. 11, no. 3, pp. 316-318. Reason for exclusion: Title abstract first pass ; : Excluded. Moskowitz, M. J., Ryan, T. P., Paulsen, K. D., & Mitchell, S. E. 1995, "Clinical implementation of electrical impedance tomography with hyperthermia", International Journal of Hyperthermia, vol. 11, no. 2, pp. 141-149. Reason for exclusion: Title abstract first pass ; : Excluded. Mote, P. A., Leary, J. A., & Clarke, C. L. 1998, "Immunohistochemical detection of progesterone receptors in archival breast cancer", Biotechnic and Histochemistry, vol. 73, no. 3, pp. 117-127. Reason for exclusion: Title abstract first pass ; : Excluded. Mueller-Lisse, U. G., Heuck, A. F., Thoma, M., Muschter, R., Schneede, P., Weninger, E., Faber, S., Hofstetter, A., & Reiser, M. F. 1998, "Predictability of the size of laserinduced lesions in T1-weighted MR images obtained during interstitial laser-induced thermotherapy of benign prostatic hyperplasia", Journal of Magnetic Resonance Imaging, vol. 8, no. 1, pp. 31-39. Reason for exclusion: Title abstract first pass ; : Excluded. Mueller, M., Wacker, K., Hickey, W. F., Ringelstein, E. B., & Kiefer, R. 2000, "Co-localization of multiple antigens and specific DNA: A novel method using methyl methacrylate-embedded semithin serial sections and catalyzed reporter deposition", American Journal of Pathology, vol. 157, no. 6, pp. 1829-1838. Reason for exclusion: Title abstract first pass ; : Excluded. Muggianu, M., Rainero, M. L., Panarese, P., Raposio, E., Franzone, P., & Guenzi, M. 1994, "Radiotherapy and hyperthermia in the treatment of primary Merkel cell carcinoma of the skin: A case report", Bulletin du Cancer Radiotherapie, vol. 81, no. 3, pp. 237-240. Reason for exclusion: Title abstract first pass ; : Excluded. Mukaisho, K. I., Kurumi, Y., Sugihara, H., Naka, S., Kamitani, S., Tsubosa, Y., Moritani, S., Endo, Y., Hanasawa, K., Morikawa, S., Inubushi, T., Hattori, T., & Tani, T. 2002, "Enzyme histochemistry is useful to assess viability of tumor tissue after microwave coagulation therapy MCT ; : Metastatic adenocarcinoma treated by lateral segmentectomy after MCT", Digestive Diseases and Sciences, vol. 47, no. 11, pp. 2441-2445. Reason for exclusion: Title abstract first pass ; : Excluded. Mukherjee, P., Banerjee, K., & Das, S. K. 2000, "Synergistic cell killing by combination therapy of retinoic acid and hyperthermia in human epidermoid laryngeal carcinoma cells in culture", Neoplasma, vol. 47, no. 1, pp. 60-67. Reason for exclusion: Title abstract first pass ; : Excluded. Muller, H. & Nakchbandi, V. 2004, "Cytoreductive surgery plus intraperitoneal hyperthermic perfusion is an effective treatment for metastasized malignant mixed mesodermal tumours MMMT ; - Report of six cases", European Journal of Surgical Oncology, vol. 30, no. 5, pp. 573-577. Reason for exclusion: Title abstract first pass ; : Excluded and formoterol.
Lymphocytic leukemia? Haematologica. 2001; 86: 8-12. [PMID: 11146563] 8. Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical staging of chronic lymphocytic leukemia. Blood. 1975; 46: 219-34. [PMID: 1139039] 9. Binet JL, Lepoprier M, Dighiero G, Charron D, D'Athis P, Vaugier G, et al. A clinical staging system for chronic lymphocytic leukemia: prognostic significance. Cancer. 1977; 40: 855-64. [PMID: 890666] 10. Binet JL, Auquier A, Dighiero G, Chastang C, Piguet H, Goasguen J, et al. A new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis. Cancer. 1981; 48: 198-206. [PMID: 7237385] 11. Cheson BD, Bennett JM, Grever M, Kay N, Keating MJ, O'Brien S, et al. National Cancer Institute-sponsored Working Group guidelines for chronic lymphocytic leukemia: revised guidelines for diagnosis and treatment. Blood. 1996; 87: 4990-7. [PMID: 8652811] 12. Rai KR, Peterson BL, Appelbaum FR, Kolitz J, Elias L, Shepherd L, et al. Fludarabine compared with chlorambucil as primary therapy for chronic lymphocytic leukemia. N Engl J Med. 2000; 343: 1750-7. [PMID: 11114313] 13. Chemotherapeutic options in chronic lymphocytic leukemia: a meta-analysis of the randomized trials. CLL Trialists' Collaborative Group. J Natl Cancer Inst. 1999; 91: 861-8. [PMID: 10340906] 14. Dighiero G, Maloum K, Desablens B, Cazin B, Navarro M, Leblay R, et al. Chlorambucil in indolent chronic lymphocytic leukemia. French Cooperative Group on Chronic Lymphocytic Leukemia. N Engl J Med. 1998; 338: 1506-14. [PMID: 9593789] 15. Diehl LF, Karnell LH, Menck HR. The American College of Surgeons Commission on Cancer and the American Cancer Society. The National Cancer Data Base report on age, gender, treatment, and outcomes of patients with chronic lymphocytic leukemia. Cancer. 1999; 86: 2684-92. [PMID: 10594864] 16. Molica S, Levato D, Dattilo A. Natural history of early chronic lymphocytic leukemia. A single institution study with emphasis on the impact of diseaseprogression on overall survival. Haematologica. 1999; 84: 1094-9. [PMID: 10586211] 17. Damle RN, Wasil T, Fais F, Ghiotto F, Valetto A, Allen SL, et al. Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia. Blood. 1999; 94: 1840-7. [PMID: 10477712] 18. Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK. Unmutated Ig V H ; genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood. 1999; 94: 1848-54. [PMID: 10477713] 19. Rassenti LZ, Huynh L, Toy TL, Chen L, Keating MJ, Gribben JG, et al. ZAP-70 compared with immunoglobulin heavy-chain gene mutation status as a predictor of disease progression in chronic lymphocytic leukemia. N Engl J Med. 2004; 351: 893-901. [PMID: 15329427] 20. Shanafelt TD, Geyer SM, Kay NE. Prognosis at diagnosis: integrating molecular biologic insights into clinical practice for patients with CLL. Blood. 2004; 103: 1202-10. [PMID: 14576043] 21. Zent CS, Kyasa MJ, Evans R, Schichman SA. Chronic lymphocytic leukemia incidence is substantially higher than estimated from tumor registry data. Cancer. 2001; 92: 1325-30. [PMID: 11571749] 22. Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman J, et al. World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting--Airlie House, Virginia, November 1997. J Clin Oncol. 1999; 17: 3835-49. [PMID: 10577857] 23. Nowakowski GS, Dewald GW, Hoyer JD, Paternoster SF, Stockero KJ, Fink SR, et al. Interphase fluorescence in situ hybridization with an IGH probe is important in the evaluation of patients with a clinical diagnosis of chronic lymphocytic leukaemia. Br J Haematol. 2005; 130: 36-42. [PMID: 15982342] 24. Shanafelt TD, Call TG. Current approach to diagnosis and management of chronic lymphocytic leukemia. Mayo Clin Proc. 2004; 79: 388-98. [PMID: 15008611] 25. Marti GE, Muller JG, Stetler-Stevenson M, Caporaso N. B-cell monoclonal lymphocytosis in three individuals living near a hazardous waste site. In: Marti GE, Vogt RF Jr, Zenger VE, eds. Proceedings of a USPHS Workshop on Laboratory Approaches to Determining the Role of Environmental Exposures as Risk Factors for B-Cell Chronic Lymphocytic Leukemia and Other B-Cell Lymphoproliferative Disorders. Atlanta: U.S. Public Health Service; 1997: 37-50. 26. Sarasua SM, Vogt RF Jr, Middleton DC, Slade BA, McGeehin MA, Lybarger JA. "CLL-like" B-cell phenotypes detected in superfund studies: epidemiologic methods and findings. In: Marti GE, Vogt RF Jr, Zenger VE, eds. Proceedings of a USPHS Workshop on Laboratory Approaches to Determining the Role.
Fludarabine refractory
Fludarabine in cll
Fludarabije, fludwrabine, flkdarabine, fl8darabine, gludarabine, fludarsbine, fludagabine, fludarabihe, fludrabine, fludarabkne, fludraabine, lfudarabine, foudarabine, flduarabine, fludqrabine, fludarbaine, fl7darabine, fludsrabine, fluudarabine, fludarabinw, fludarwbine, fludarabinee, flufarabine, fludaranine, fludarabinr, fludarqbine, flucarabine, fludarabinf, fludarrabine, fludarabin4, fludarabone, fludarzbine, flludarabine, fludarabins, fluddarabine, vludarabine, fluxarabine, fludatabine, fludarabibe, fluarabine, fluda4abine, fludarabie, fluda5abine, fludzrabine, flydarabine, fludaarabine.
Fludarabine label
Fludarabine prophylaxis, fludarabine chemotherapy, fludarabine refractory, fludarabine in cll and fludarabine label. Fludarabine cost, fludarabine oral, rituximab fludarabine waldenstrom and fludarabine for men or fludarabine alcohol.
|